Precursor miRBase

oha-mir-9-3 (MI0031489)

Accession MI0031489
Name oha-mir-9-3
similar to following miRCarta precursors oha-37092-37091.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01005650.1:31,860-31,944 (-)
miRNA oha-miR-9-3-5p
miRNA oha-miR-9-3p
Sequence (5' -> 3')
(85 nts)
UCGGUUUAUACAUUCGGUUCUCUAGCUUUAUGAUAUCAGAUACACUCAUACAGCUAGAUAACCAAAGAGAAAAACCGGCCCUGUG
MFE -24.50 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-9-3
Family mir-9 (MIPF0000014)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.