Precursor miRBase

oha-mir-338 (MI0031458)

Accession MI0031458
Name oha-mir-338
similar to following miRCarta precursors oha-36911-118.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000013.1:479,336-479,409 (-)
miRNA oha-miR-338-5p
miRNA oha-miR-338-3p
Sequence (5' -> 3')
(74 nts)
CCGUCAACAAUAUCCUGGUGCUGAGUGAGUGGCACUCGGAGACUCCAGCAUCAGUGAUUUUGUUGAAGAGGGGG
MFE -30.10 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-338
Family mir-338 (MIPF0000097)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.