Precursor miRBase

oha-mir-29b-1 (MI0031444)

Accession MI0031444
Name oha-mir-29b-1
similar to following miRCarta precursors oha-37096-37095.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01006006.1:36,965-37,054 (+)
miRNA oha-miR-29b-1-5p
miRNA oha-miR-29b-3p
Sequence (5' -> 3')
(90 nts)
AGCUCCUUCAGGAAUCUGGUUUCAUAUGGUGGUUUAGAUUUAAGUACACAAUGUCUAGCACCAUUUGAAAUCAGUGUUUUUGGGGGAAGA
MFE -36.10 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-29b-1
oha-mir-29a-1
Family mir-29 (MIPF0000009)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.