Precursor miRBase

oha-mir-221 (MI0031426)

Accession MI0031426
Name oha-mir-221
similar to following miRCarta precursors oha-37017-91.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01002126.1:54,879-54,982 (-)
miRNA oha-miR-221-5p
miRNA oha-miR-221-3p
Sequence (5' -> 3')
(104 nts)
GAUGAUCCAGCUUUUGGGCCUUCACCUGGCAUACAAUGUAGAAUACUGUGUUUGUUAAGCAACAGCUACAUUGUCUGCUGGGUUUCAGGCUGUCUGGAAGUACA
MFE -38.90 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-221
oha-mir-222a
Family mir-221 (MIPF0000051)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.