Precursor miRBase

oha-mir-219-1 (MI0031422)

Accession MI0031422
Name oha-mir-219-1
similar to following miRCarta precursors oha-860-37109.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01007581.1:26,349-26,428 (-)
miRNA oha-miR-219-5p
miRNA oha-miR-219-1-3p
Sequence (5' -> 3')
(80 nts)
CUCCUGAUUGUCCAAACGCAAUUCUUGUCCAGAAAAACAUGCAAACCAAGAAUUGUGUCUGGACAUCGGUGGCUGAGUCU
MFE -27.20 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-219-1
Family mir-219 (MIPF0000044)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.