Precursor miRBase

oha-mir-218-2 (MI0031420)

Accession MI0031420
Name oha-mir-218-2
similar to following miRCarta precursors oha-187-28328.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000153.1:403,906-404,006 (+)
miRNA oha-miR-218-5p
miRNA oha-miR-218-2-3p
Sequence (5' -> 3')
(101 nts)
GGGAUUUUCCUUUGUGCUUGAUCUAACCAUGUGGUAGAACAAUACAAAUUGAACAUGGUUCUGUCAAGCACCAUGGAAGGCUCCAUGCUUUCCUGCAGCAU
MFE -35.90 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-218-2
Family mir-218 (MIPF0000026)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.