Precursor miRBase

oha-mir-216 (MI0031417)

Accession MI0031417
Name oha-mir-216
similar to following miRCarta precursors oha-26295-36960.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000377.1:298,835-298,941 (-)
miRNA oha-miR-216-5p
miRNA oha-miR-216-3p
Sequence (5' -> 3')
(107 nts)
CAUAGAUGGCUGUGAAUUGGUUUAAUCUCAGCUGGCAACUGUGAGCAGUUAAUAAAUCCUCUCACAGUGGUAUCUGGGAUUAUACUAAACACAGCAAUUUCCGUGCU
MFE -39.60 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-217
oha-mir-216
Family mir-216 (MIPF0000054)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.