Accession | MI0031417 |
Name | oha-mir-216 |
similar to following miRCarta precursors | oha-26295-36960.1 |
Organism | Ophiophagus hannah |
Genome | OphHan1.0 |
Location |
AZIM01000377.1:298,835-298,941 (-) |
miRNA | oha-miR-216-5p |
miRNA | oha-miR-216-3p |
Sequence (5' -> 3') (107 nts) |
CAUAGAUGGCUGUGAAUUGGUUUAAUCUCAGCUGGCAACUGUGAGCAGUUAAUAAAUCCUCUCACAGUGGUAUCUGGGAUUAUACUAAACACAGCAAUUUCCGUGCU |
MFE | -39.60 kcal/mol |
first miRBase version | 21.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (2 precursors) |
oha-mir-217
oha-mir-216 |
Family | mir-216 (MIPF0000054) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Vonk et al. | Proc. Natl. Acad. Sci. U.S.A. | 2013 | 24297900 | The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system. |