Precursor miRBase

oha-mir-215 (MI0031416)

Accession MI0031416
Name oha-mir-215
similar to following miRCarta precursors oha-37003-37002.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01001511.1:634,812-634,900 (+)
miRNA oha-miR-215-5p
miRNA oha-miR-215-3p
Sequence (5' -> 3')
(89 nts)
AGGGUAAUGACCUAUGAUUUGACAGACUGUGCUAUCUAAGUCUGCCUGUCAUUUCUGUAGGCCAAUACUCUGCAUGUUCACUACUCUAC
MFE -23.20 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-194-1
oha-mir-215
Family mir-192 (MIPF0000063)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.