Precursor miRBase

oha-mir-204-2 (MI0031405)

Accession MI0031405
Name oha-mir-204-2
similar to following miRCarta precursors oha-36945-36944.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000190.1:1,085,405-1,085,498 (+)
miRNA oha-miR-204-5p
miRNA oha-miR-204-2-3p
Sequence (5' -> 3')
(94 nts)
CCUCAUGACCUGCGGGGUUCCCUUUGUCAUCCUAUGCCUGGAGCUCAGAGUGAGGCAGGGGUCGCAAAGGGCUGCUCAGCUGUUGUUUCUAACG
MFE -34.20 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-204-2
Family mir-204 (MIPF0000042)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.