Precursor miRBase

oha-mir-144 (MI0031357)

Accession MI0031357
Name oha-mir-144
similar to following miRCarta precursors oha-37061-25849.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01003573.1:17,943-18,012 (-)
miRNA oha-miR-144-5p
miRNA oha-miR-144-3p
Sequence (5' -> 3')
(70 nts)
UCCAGCUCGGAUAUCAUCAUAUACUGUAAGUUGGAAUCAGACACUACAGUAUAGAUGAUGUACUAUCUGG
MFE -24.40 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-451
oha-mir-144
Family mir-144 (MIPF0000093)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.