Precursor miRBase

oha-mir-138-2 (MI0031350)

Accession MI0031350
Name oha-mir-138-2
similar to following miRCarta precursors oha-37007-37006.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01001672.1:63,853-63,930 (-)
miRNA oha-miR-138-5p
miRNA oha-miR-138-2-3p
Sequence (5' -> 3')
(78 nts)
GCUGCAGCUGGUGUUGUGAAUCAGGCCGACAAAAAGUGCGUCUUACUAUCCGGCUAUUUCACUACACCAGGGUCGCAU
MFE -28.20 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-138-2
Family mir-138 (MIPF0000075)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.