Precursor miRBase

oha-mir-138-1 (MI0031349)

Accession MI0031349
Name oha-mir-138-1
similar to following miRCarta precursors oha-35844-37089.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01005485.1:8,165-8,235 (-)
miRNA oha-miR-138-5p
miRNA oha-miR-138-1-3p
Sequence (5' -> 3')
(71 nts)
UGUAGCAGCUGGUGUUGUGAAUCAGGCCGUCAUCCAUUAGAGAACGGCUACUUCACAACACCAGGGUUGCU
MFE -37.30 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-138-1
Family mir-138 (MIPF0000075)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.