Precursor miRBase

oha-mir-135-3 (MI0031347)

Accession MI0031347
Name oha-mir-135-3
similar to following miRCarta precursors oha-36926-36866.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01001051.1:235,831-235,918 (-)
miRNA oha-miR-135-5p
miRNA oha-miR-135-3-3p
Sequence (5' -> 3')
(88 nts)
AAUCCUCUGCUGUGGUCUAUGGCUUUUUAUUCCUAUGUGAUUACUUUUUAUAAUUCAUGUAGGGCUAAAAGCCAUGGGUUACACAAAG
MFE -30.60 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-135-3
Family mir-135 (MIPF0000028)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.