Precursor miRBase

oha-mir-133b (MI0031343)

Accession MI0031343
Name oha-mir-133b
similar to following miRCarta precursors oha-37008-34425.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01001691.1:30,573-30,658 (-)
miRNA oha-miR-133b-5p
miRNA oha-miR-133b-3p
Sequence (5' -> 3')
(86 nts)
GCAUUGCUCUGGCUGGUCAAAAGGAACCAAGGCCGUCUCUCCUGGAGGUUUGGUCCCCUUCAACCAGCUAUAGCAGUGCUGACCUU
MFE -40.00 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-133b
oha-mir-206
Family mir-133 (MIPF0000029)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.