Precursor miRBase

oha-mir-133a-2 (MI0031342)

Accession MI0031342
Name oha-mir-133a-2
similar to following miRCarta precursors oha-26061-320.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01006716.1:100,339-100,415 (-)
miRNA oha-miR-133a-2-5p
miRNA oha-miR-133a-3p
Sequence (5' -> 3')
(77 nts)
CUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCAAGUGUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGUGC
MFE -29.00 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-133a-2
Family mir-133 (MIPF0000029)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.