Precursor miRBase

oha-mir-100 (MI0031313)

Accession MI0031313
Name oha-mir-100
similar to following miRCarta precursors oha-35949-37026.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01002460.1:28,414-28,497 (-)
miRNA oha-miR-100-5p
miRNA oha-miR-100-3p
Sequence (5' -> 3')
(84 nts)
CCUGCCGGUUGCCACAAACCCGUAGAUCCGAACUUGUGCUCCUAUCCUACACAAGCUUGUAUCUAUAGGUAUGUGUCUGCUUGG
MFE -24.90 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-let-7c-1
oha-mir-100
Family mir-10 (MIPF0000033)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.