Precursor miRBase

tch-mir-504 (MI0031274)

Accession MI0031274
Name tch-mir-504
similar to following miRCarta precursors tch-25659.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB321176.1:3,177,368-3,177,426 (+)
miRNA tch-miR-504
Sequence (5' -> 3')
(59 nts)
AGACCCUGGUCUGCACUCUAUCUGUAUGCUUUUUAAAGGGAGCGCAGGGCAGGGUUUCC
MFE -25.50 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-504
Family mir-504 (MIPF0000437)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR504
NCBI Gene 104796610

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.