Precursor miRBase

tch-mir-7-3 (MI0031202)

Accession MI0031202
Name tch-mir-7-3
similar to following miRCarta precursors tch-401.1 tch-401.2
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB320564.1:21,665-21,728 (+)
miRNA tch-miR-7-5p
Sequence (5' -> 3')
(64 nts)
UGGAAGACUAGUGAUUUUGUUGUUUUUAGAUAACUAAAUCGACAACAAAUCACAGUCUGCCAUA
MFE -24.90 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-7-3
Family mir-7 (MIPF0000022)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR7-3
NCBI Gene 104796000

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.