Precursor miRBase

tch-mir-7-2 (MI0031183)

Accession MI0031183
Name tch-mir-7-2
similar to following miRCarta precursors tch-26613.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB320802.1:367,811-367,872 (+)
miRNA tch-miR-7-5p
Sequence (5' -> 3')
(62 nts)
UGGAAGACUAGUGAUUUUGUUGUUGUGUCACUAUACUCAACAACAAGUCCCAGUCUGCCACA
MFE -20.60 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-7-2
Family mir-7 (MIPF0000022)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR7-2
NCBI Gene 104797324

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.