Precursor miRBase

tch-mir-342 (MI0031145)

Accession MI0031145
Name tch-mir-342
similar to following miRCarta precursors tch-128.1
Organism Tupaia chinensis
Genome TupChi_1.0
Location KB321140.1:3,992,730-3,992,792 (+)
miRNA tch-miR-342-3p
Sequence (5' -> 3')
(63 nts)
AGGGGUGCUAUCUGUGACUGAGGGCAUGGUCAGCGGAUUGUCUCACACAGAAAUCGCACCCGU
MFE -24.30 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
tch-mir-342
Family mir-342 (MIPF0000190)
Experiments
experiment Pubmed link
Illumina 24314655
External DBs
Gene symbol MIR342
NCBI Gene 104796278

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xu et al. Virology 2014 24314655 microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture.