| Accession | MI0031134 | ||||
| Name | tch-mir-450a-1 | ||||
| similar to following miRCarta precursors | tch-288.1 | ||||
| Organism | Tupaia chinensis | ||||
| Genome | TupChi_1.0 | ||||
| Location |
KB370352.1:2,042,126-2,042,183 (-) |
||||
| miRNA | tch-miR-450a-5p | ||||
| Sequence (5' -> 3') (58 nts) |
UUUUGCGAUGUGUUCCUAAUAUGCAUUUAGAAAUAUAUUGGGAACAUUUUGCAUGCAU | ||||
| MFE | -21.30 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (5 precursors) |
tch-mir-450a-1 tch-mir-450a-2 tch-mir-542 tch-mir-503 tch-mir-424 |
||||
| Family | mir-450 (MIPF0000128) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Xu et al. | Virology | 2014 | 24314655 | microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture. |