| Accession | MI0031131 | ||||
| Name | tch-mir-155 | ||||
| similar to following miRCarta precursors | tch-109.1 | ||||
| Organism | Tupaia chinensis | ||||
| Genome | TupChi_1.0 | ||||
| Location |
KB321016.1:1,227,767-1,227,827 (+) |
||||
| miRNA | tch-miR-155-5p | ||||
| Sequence (5' -> 3') (61 nts) |
UUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCGACUGACUCCUACAUGUUAGCAUUAACA | ||||
| MFE | -24.30 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
tch-mir-155 |
||||
| Family | mir-155 (MIPF0000157) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Xu et al. | Virology | 2014 | 24314655 | microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture. |