Accession | MI0031106 |
Name | ppy-mir-521-3 |
similar to following miRCarta precursors | ppy-974.2 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
19:55,522,703-55,522,821 (+) |
miRNA | ppy-miR-521 |
Sequence (5' -> 3') (119 nts) |
CUGGAGCAAGAAGAUCUUAUGCUGUGACCCUCCAAAGGGAAGAACUUUCUGUUGUCUAAAAGAAAAGAACGCACUUCCCUUUAGAGUGUUACCGUGUGAGAAAAGCAACGUUGAAGUUG |
MFE | -36.00 kcal/mol |
first miRBase version | 21.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (5 precursors) |
ppy-mir-520i
ppy-mir-520h ppy-mir-521-3 ppy-mir-521-1 ppy-mir-522 |
Family | mir-515 (MIPF0000020) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Kamanu et al. | Sci Rep | 2013 | 24126940 | Exploration of miRNA families for hypotheses generation. |