Accession | MI0031104 |
Name | ppy-mir-518g |
similar to following miRCarta precursors | ppy-896-888.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
19:55,504,419-55,504,527 (+) |
miRNA | ppy-miR-518g-5p |
miRNA | ppy-miR-518g-3p |
Sequence (5' -> 3') (109 nts) |
CUGGAGCAAGAAGAUCUCAUGAUGUGACCCCUCUAGAGGGAAGCACUUUCUGUUGGCUAAAAGAAAAAGAAAGCGCUUCCCUUCAGAGUGUUACGCUUUGAGAAAAGCA |
MFE | -39.10 kcal/mol |
first miRBase version | 21.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (7 precursors) |
ppy-mir-517c-3
ppy-mir-520g ppy-mir-516b-2 ppy-mir-518g ppy-mir-1283b ppy-mir-516b-1 ppy-mir-520i |
Family | mir-515 (MIPF0000020) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Kamanu et al. | Sci Rep | 2013 | 24126940 | Exploration of miRNA families for hypotheses generation. |