Accession | MI0030726 | ||||
Name | chi-mir-29a | ||||
similar to following miRCarta precursors | chi-315-26.1 | ||||
Organism | Capra hircus | ||||
Genome | CHIR_1.0 | ||||
Location |
chr4:92,111,188-92,111,274 (-) |
||||
miRNA | chi-miR-29a-5p | ||||
miRNA | chi-miR-29a-3p | ||||
Sequence (5' -> 3') (87 nts) |
CCCCUUAGAGGAUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUCUGAAAUCGGUUAUAAUGAUUGGGGA | ||||
MFE | -33.90 kcal/mol | ||||
first miRBase version | 21.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
chi-mir-29a |
||||
Family | mir-29 (MIPF0000009) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Wu et al. | Reprod. Domest. Anim. | 2014 | 23981187 | Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing. |