| Accession | MI0030618 | ||||
| Name | chi-mir-133a | ||||
| similar to following miRCarta precursors | chi-26061-320.1 | ||||
| Organism | Capra hircus | ||||
| Genome | CHIR_1.0 | ||||
| Location |
chr13:52,712,991-52,713,085 (-) |
||||
| miRNA | chi-miR-133a-5p | ||||
| miRNA | chi-miR-133a-3p | ||||
| Sequence (5' -> 3') (95 nts) |
CGGGACCGAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCAACUGUUCGAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGUGCAUUGAU | ||||
| MFE | -34.60 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
chi-mir-133a |
||||
| Family | mir-133 (MIPF0000029) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wu et al. | Reprod. Domest. Anim. | 2014 | 23981187 | Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing. |