Accession | MI0030582 | ||||
Name | chi-let-7d | ||||
similar to following miRCarta precursors | chi-90-98.1 | ||||
Organism | Capra hircus | ||||
Genome | CHIR_1.0 | ||||
Location |
chr8:83,556,514-83,556,618 (+) |
||||
miRNA | chi-let-7d-5p | ||||
miRNA | chi-let-7d-3p | ||||
Sequence (5' -> 3') (105 nts) |
AAUGGGUUCCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGGGAUUUUGCCCACAAGGAGGUAACUAUACGACCUGCUGCCUUUCUUAGGGCCUUAUUAU | ||||
MFE | -48.80 kcal/mol | ||||
first miRBase version | 21.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
chi-let-7f
chi-let-7d |
||||
Family | let-7 (MIPF0000002) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Wu et al. | Reprod. Domest. Anim. | 2014 | 23981187 | Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing. |