| Accession | MI0028791 | ||||
| Name | efu-mir-338 | ||||
| similar to following miRCarta precursors | efu-32448.1 | ||||
| Organism | Eptesicus fuscus | ||||
| Genome | EptFus1.0 | ||||
| Location |
JH977722.1:1,021,155-1,021,295 (+) |
||||
| miRNA | efu-miR-338 | ||||
| Sequence (5' -> 3') (141 nts) |
AAUGGCGAUGACGUGGCCUGGAUGAGACGGGCCGUCCUCCCCAACAAGAUCCUGGUGCUGAGUGAUGACUCGCAACUCCAGCAUCAGUGAUUUUGUUGAAGAGGGCAGCCUCCCGCCUCCCGCCUGCCGCGCCCACUCGCC | ||||
| MFE | -68.60 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
efu-mir-338 |
||||
| Family | mir-338 (MIPF0000097) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Platt et al. | Mol. Biol. Evol. | 2014 | 24692655 | Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats. |