| Accession | MI0028172 | ||||
| Name | eca-mir-3200 | ||||
| similar to following miRCarta precursors | eca-355.1 | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chr8:6,217,988-6,218,130 (-) |
||||
| miRNA | eca-miR-3200 | ||||
| Sequence (5' -> 3') (143 nts) |
CACCGACCGAGAGAGACAGAAAAGGAGGCGGUCGAGGGAAUCUGAGAAGGCGCACAAGGUUUGUGUCCAAUACGCUCCACACCUUGCGCUACUCAGGUCUGCUCGUGCCCUCCCAUGGUAUCAGCUCUCCUGCGAUGUGGGGA | ||||
| MFE | -47.10 kcal/mol | ||||
| first miRBase version | 21.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
eca-mir-3200 |
||||
| Family | mir-3200 (MIPF0001441) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Platt et al. | Mol. Biol. Evol. | 2014 | 24692655 | Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats. |