| Accession | MI0025539 | ||||
| Name | bta-mir-219-2 | ||||
| similar to following miRCarta precursors | bta-438.1 | ||||
| potential naming conflicts with | bta-mir-219-2 (MI0012210) | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr23:7,335,350-7,335,412 (-) |
||||
| miRNA | bta-miR-219 | ||||
| Sequence (5' -> 3') (63 nts) |
UGAUUGUCCAAACGCAAUUCUCGAGUCUCUAGCUCUGGCCGAGAGUUGAGUCUGGACGUCCCG | ||||
| MFE | -26.10 kcal/mol | ||||
| first miRBase version | 20.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
bta-mir-219-2 |
||||
| Family | mir-219 (MIPF0000044) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lawless et al. | PLoS ONE | 2013 | 23472090 | Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection. |