| Accession | MI0025282 | ||||
| Name | oar-mir-106a | ||||
| similar to following miRCarta precursors | oar-242.1 | ||||
| Organism | Ovis aries | ||||
| Genome | Oar_v3.1 | ||||
| Location |
chrX:95,607,797-95,607,877 (+) |
||||
| miRNA | oar-miR-106a | ||||
| Sequence (5' -> 3') (81 nts) |
CCUUGGCCAUGUAAAAGUGCUUACAGUGCAGGUAGCUUUUUGAGAUCUACUGCAAUGCAAGCACUUCUUACAUUACCAUGG | ||||
| MFE | -29.70 kcal/mol | ||||
| first miRBase version | 20.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
oar-mir-106a |
||||
| Family | mir-17 (MIPF0000001) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Galio et al. | Physiol. Genomics | 2013 | 23269700 | MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200. |