| Accession | MI0025246 | ||||
| Name | oar-let-7g | ||||
| similar to following miRCarta precursors | oar-58.1 | ||||
| potential naming conflicts with | oar-let-7g (MIMAT0030025) | ||||
| Organism | Ovis aries | ||||
| Genome | Oar_v3.1 | ||||
| Location |
chr19:48,603,621-48,603,703 (+) |
||||
| miRNA | oar-let-7g | ||||
| Sequence (5' -> 3') (83 nts) |
AGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCC | ||||
| MFE | -38.00 kcal/mol | ||||
| first miRBase version | 20.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
oar-let-7g |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Galio et al. | Physiol. Genomics | 2013 | 23269700 | MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200. |