Accession | MI0025246 | ||||
Name | oar-let-7g | ||||
similar to following miRCarta precursors | oar-58.1 | ||||
potential naming conflicts with | oar-let-7g (MIMAT0030025) | ||||
Organism | Ovis aries | ||||
Genome | Oar_v3.1 | ||||
Location |
chr19:48,603,621-48,603,703 (+) |
||||
miRNA | oar-let-7g | ||||
Sequence (5' -> 3') (83 nts) |
AGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCC | ||||
MFE | -38.00 kcal/mol | ||||
first miRBase version | 20.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
oar-let-7g |
||||
Family | let-7 (MIPF0000002) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Galio et al. | Physiol. Genomics | 2013 | 23269700 | MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200. |