Accession | MI0025244 | ||||
Name | oar-let-7d | ||||
similar to following miRCarta precursors | oar-90.1 | ||||
potential naming conflicts with | oar-let-7d (MIMAT0030023) | ||||
Organism | Ovis aries | ||||
Genome | Oar_v3.1 | ||||
Location |
chr2:27,312,334-27,312,420 (-) |
||||
miRNA | oar-let-7d | ||||
Sequence (5' -> 3') (87 nts) |
CCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGGGAUUUUGCCCACAAGGAGGUAACUAUACGACCUGCUGCCUUUCUUAGG | ||||
MFE | -42.70 kcal/mol | ||||
first miRBase version | 20.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
oar-let-7d oar-let-7a |
||||
Family | let-7 (MIPF0000002) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Galio et al. | Physiol. Genomics | 2013 | 23269700 | MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200. |