| Accession | MI0023783 | ||||
| Name | mdo-mir-219-2 | ||||
| similar to following miRCarta precursors | mdo-28170-28169.1 | ||||
| Organism | Monodelphis domestica | ||||
| Genome | monDom5 | ||||
| Location |
chr2:270,698,645-270,698,704 (+) |
||||
| miRNA | mdo-miR-219-5p | ||||
| miRNA | mdo-miR-219-2-3p | ||||
| Sequence (5' -> 3') (60 nts) |
UGAUUGUCCAAACGCAAUUCUCGUGGCUCCGGCCCUCGAGAGUUGGGUCUGGACAUCCCG | ||||
| MFE | -31.90 kcal/mol | ||||
| first miRBase version | 20.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
mdo-mir-219-2 |
||||
| Family | mir-219 (MIPF0000044) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |