| Accession | MI0023565 | ||||
| Name | hsa-mir-6511a-3 | ||||
| similar to following miRCarta precursors | hsa-1088-335.3 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr16:16,368,876-16,368,942 (+) |
||||
| miRNA | hsa-miR-6511a-5p | ||||
| miRNA | hsa-miR-6511a-3p | ||||
| Sequence (5' -> 3') (67 nts) |
CCUGCAGGCAGAAGUGGGGCUGACAGGGCAGAGGGUUGCGCCCCCUCACCAUCCCUUCUGCCUGCAG | ||||
| MFE | -37.90 kcal/mol | ||||
| first miRBase version | 19.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-6511a-3 |
||||
| Family | mir-6511 (MIPF0001382) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Joyce et al. | Hum. Mol. Genet. | 2011 | 21807764 | Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome. |
| 2 | Li et al. | Gene | 2012 | 22313525 | Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis. |