Accession | MI0022199 | ||||
Name | pol-mir-133 | ||||
similar to following miRCarta precursors | pol-31750-26036.1 | ||||
Organism | Paralichthys olivaceus | ||||
miRNA | pol-miR-133-5p | ||||
miRNA | pol-miR-133-3p | ||||
Sequence (5' -> 3') (60 nts) |
GCUGGUCAAACGGAACCAAGUCAGGUGUUUCUGUGAGGUUUGGUCCCCUUCAACCAGCUA | ||||
MFE | -19.30 kcal/mol | ||||
first miRBase version | 19.0 | ||||
last miRBase version | 21.0 | ||||
Family | mir-133 (MIPF0000029) | ||||
Experiments |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Fu et al. | PLoS ONE | 2011 | 21818405 | Identification and differential expression of microRNAs during metamorphosis of the Japanese flounder (Paralichthys olivaceus). |