| Accession | MI0021727 | ||||
| Name | hme-mir-10 | ||||
| similar to following miRCarta precursors | hme-30114.1 | ||||
| Organism | Heliconius melpomene | ||||
| Genome | HelMel1.1 | ||||
| Location |
HE667778:152,714-152,795 (-) |
||||
| miRNA | hme-miR-10 | ||||
| Sequence (5' -> 3') (82 nts) |
GUGCCCUACAUCUACCCUGUAGAUCCGAAUUUGUUUGAAGUGAGGCGACAAAUUCGGUUCUAGAGAGGUUUGUGUGGUGCAU | ||||
| MFE | -36.50 kcal/mol | ||||
| first miRBase version | 19.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hme-mir-10 |
||||
| Family | mir-10 (MIPF0000033) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Heliconius Genome Consortium et al. | Nature | 2012 | 22722851 | Butterfly genome reveals promiscuous exchange of mimicry adaptations among species. |