| Accession | MI0020942 | ||||
| Name | ppy-mir-151b | ||||
| similar to following miRCarta precursors | ppy-30413.1 | ||||
| Organism | Pongo abelii | ||||
| Genome | PPYG2 | ||||
| Location |
14:101,636,045-101,636,154 (-) |
||||
| miRNA | ppy-miR-151b | ||||
| Sequence (5' -> 3') (110 nts) |
UCACCAGACACCUCUGAUGUGUCAGUCUCUCUUCAGGGCUCCCGAGACACAGAAACAGACACCUGCCCUCCAGGAGCUCACAGUCUAGACAAACGAACCCAGGGUCCAAA | ||||
| MFE | -25.50 kcal/mol | ||||
| first miRBase version | 19.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
ppy-mir-151b ppy-mir-342 |
||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Dannemann et al. | BMC Genomics | 2012 | 22453055 | Annotation of primate miRNAs by high throughput sequencing of small RNA libraries. |