Precursor miRBase

ggo-mir-342 (MI0020648)

Accession MI0020648
Name ggo-mir-342
similar to following miRCarta precursors ggo-128.1
Organism Gorilla gorilla
Genome GorGor3
Location 14:82,069,652-82,069,763 (+)
miRNA ggo-miR-342
Sequence (5' -> 3')
(112 nts)
GCCAACCUGUGAAACUGGGCGCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGACAUGGUUAAUGGAAUUGUCUCACACAGAAAUCGCACCCGUCACCUUGGCCUACUUAUCA
MFE -47.80 kcal/mol
first miRBase version 19.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ggo-mir-342
Family mir-342 (MIPF0000190)
Experiments
experiment Pubmed link
Illumina 22453055
External DBs
Gene symbol MIR342
NCBI Gene 102464981

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Dannemann et al. BMC Genomics 2012 22453055 Annotation of primate miRNAs by high throughput sequencing of small RNA libraries.