Accession | MI0020618 | ||||
Name | ptr-mir-449c | ||||
similar to following miRCarta precursors | ptr-882.1 | ||||
Organism | Pan troglodytes | ||||
Genome | CHIMP2.1.4 | ||||
Location |
5:60,319,592-60,319,702 (+) |
||||
miRNA | ptr-miR-449c | ||||
Sequence (5' -> 3') (111 nts) |
AAAGCUGGGAUGUGUCAGGUAGGCAGUGUAUUGCUAGCGGCUGUUAAUAAUUUUAACAGUUGCUAGUUGCACUCCUCUCUGUUGCAUUCAGAAGCACGCCCCCCAAAGAAA | ||||
MFE | -46.10 kcal/mol | ||||
first miRBase version | 19.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (3 precursors) |
ptr-mir-449c ptr-mir-449b ptr-mir-449a |
||||
Family | mir-449 (MIPF0000133) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Dannemann et al. | BMC Genomics | 2012 | 22453055 | Annotation of primate miRNAs by high throughput sequencing of small RNA libraries. |