| Accession | MI0020460 | ||||
| Name | cgr-mir-214 | ||||
| similar to following miRCarta precursors | cgr-290-38502.1 | ||||
| Organism | Cricetulus griseus | ||||
| miRNA | cgr-miR-214-5p | ||||
| miRNA | cgr-miR-214-3p | ||||
| Sequence (5' -> 3') (78 nts) |
GUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAU | ||||
| MFE | -44.00 kcal/mol | ||||
| first miRBase version | 19.0 | ||||
| last miRBase version | 21.0 | ||||
| Family | mir-214 (MIPF0000062) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Hackl et al. | J. Biotechnol. | 2011 | 21392545 | Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering. |