| Accession | MI0020346 | ||||
| Name | hsa-mir-6069 | ||||
| similar to following miRCarta precursors | hsa-2518.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr22:35,336,721-35,336,799 (-) |
||||
| miRNA | hsa-miR-6069 | ||||
| Sequence (5' -> 3') (79 nts) |
UGGUGACCCCUGGGCUAGGGCCUGCUGCCCCCUGCCCAGUGCAGGAGGGUGGAGGGUCACUCCUUAGGUGGUCCCAGUG | ||||
| MFE | -45.00 kcal/mol | ||||
| first miRBase version | 19.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-3909
hsa-mir-6069 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Voellenkle et al. | RNA | 2012 | 22282338 | Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs. |