Accession | MI0019524 | ||||
Name | ola-mir-133-1 | ||||
similar to following miRCarta precursors | ola-25776-40088.1 | ||||
Organism | Oryzias latipes | ||||
Genome | MEDAKA1 | ||||
Location |
17:29,407,313-29,407,419 (-) |
||||
miRNA | ola-miR-133-5p | ||||
miRNA | ola-miR-133-3p | ||||
Sequence (5' -> 3') (107 nts) |
CUCUAAUCCACAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCACCUCUUGAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCUUUGAAAUCUACGAG | ||||
MFE | -33.10 kcal/mol | ||||
first miRBase version | 18.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
ola-mir-133-1 ola-mir-1-2 |
||||
Family | mir-133 (MIPF0000029) | ||||
Experiments |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Li et al. | BMC Genomics | 2010 | 21143817 | Discovery and characterization of medaka miRNA genes by next generation sequencing platform. |