| Accession | MI0019392 | ||||
| Name | tur-mir-124-2 | ||||
| similar to following miRCarta precursors | tur-42425-40214.1 | ||||
| Organism | Tetranychus urticae | ||||
| miRNA | tur-miR-124-3p | ||||
| miRNA | tur-miR-124-2-5p | ||||
| Sequence (5' -> 3') (75 nts) |
UACUCUCCGUGUUCACUGUUUGCCUUCAUGUAGAGCUUUGAUUUAUCAUAAGGCACGCGGUGAAUGCCAAGAGUU | ||||
| MFE | -31.60 kcal/mol | ||||
| first miRBase version | 19.0 | ||||
| last miRBase version | 21.0 | ||||
| Family | mir-124 (MIPF0000021) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Grbić et al. | Nature | 2011 | 22113690 | The genome of Tetranychus urticae reveals herbivorous pest adaptations. |