| Accession | MI0019144 | ||||
| Name | hsa-mir-5587 | ||||
| similar to following miRCarta precursors | hsa-1719-1493.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr16:535,316-535,368 (+) |
||||
| miRNA | hsa-miR-5587-5p | ||||
| miRNA | hsa-miR-5587-3p | ||||
| Sequence (5' -> 3') (53 nts) |
AUGGUCACCUCCGGGACUCAGCCCUGUGCUGAGCCCCGGGCAGUGUGAUCAUC | ||||
| MFE | -29.70 kcal/mol | ||||
| first miRBase version | 18.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-5587 hsa-mir-3176 |
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Friedländer et al. | Nucleic Acids Res. | 2012 | 21911355 | miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. |