| Accession | MI0018525 | ||||
| Name | asu-let-7 | ||||
| similar to following miRCarta precursors | asu-41576-41575.1 | ||||
| potential naming conflicts with | asu-let-7-5p (MIMAT0021417) | ||||
| Organism | Ascaris suum | ||||
| miRNA | asu-let-7-5p | ||||
| miRNA | asu-let-7-3p | ||||
| Sequence (5' -> 3') (84 nts) |
UCUGCUCGUUGAGGUAGUAGGUUGUAUAGUUGCGAGCUGCAUCCUUUCGAGAAACUGUCCAGCCUGCUAGCUUGCCGCGCGGAC | ||||
| MFE | -35.10 kcal/mol | ||||
| first miRBase version | 18.0 | ||||
| last miRBase version | 21.0 | ||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wang et al. | Genome Res. | 2011 | 21685128 | Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles. |