| Accession | MI0017396 | ||||
| Name | hsa-mir-499b | ||||
| similar to following miRCarta precursors | hsa-2080-2225.1 | ||||
| potential naming conflicts with | hsa-mir-499a (MI0003183) | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr20:34,990,400-34,990,472 (-) |
||||
| miRNA | hsa-miR-499b-5p | ||||
| miRNA | hsa-miR-499b-3p | ||||
| Sequence (5' -> 3') (73 nts) |
GGAAGCAGCACAGACUUGCUGUGAUGUUCACGUGGAGAGGAGUUAAACAUCACUGCAAGUCUUAACAGCCGCC | ||||
| MFE | -24.90 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-499a
hsa-mir-499b |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |