| Accession | MI0017006 | ||||
| Name | pma-mir-9a-1 | ||||
| Organism | Petromyzon marinus | ||||
| miRNA | pma-miR-9a-5p | ||||
| Sequence (5' -> 3') (88 nts) |
AGGGACGGCCCCUGUCUUUGGUUAUCUAGCUGUAUGAGUGUCAGAAUCCCGCCAUAAAGCUACUUAACCAAAAGCAGGGAUCCGUUCC | ||||
| MFE | -42.90 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Family | mir-9 (MIPF0000014) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Heimberg et al. | Proc. Natl. Acad. Sci. U.S.A. | 2010 | 20959416 | microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate. |