Precursor miRBase

pma-mir-9a-1 (MI0017006)

Accession MI0017006
Name pma-mir-9a-1
Organism Petromyzon marinus
miRNA pma-miR-9a-5p
Sequence (5' -> 3')
(88 nts)
AGGGACGGCCCCUGUCUUUGGUUAUCUAGCUGUAUGAGUGUCAGAAUCCCGCCAUAAAGCUACUUAACCAAAAGCAGGGAUCCGUUCC
MFE -42.90 kcal/mol
first miRBase version 17.0
last miRBase version 21.0
Family mir-9 (MIPF0000014)
Experiments
experiment Pubmed link
454 20959416

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Heimberg et al. Proc. Natl. Acad. Sci. U.S.A. 2010 20959416 microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate.