Accession | MI0016944 | ||||
Name | oar-mir-655 | ||||
similar to following miRCarta precursors | oar-1263-27894.1 | ||||
Organism | Ovis aries | ||||
Genome | Oar_v3.1 | ||||
Location |
chr18:64,643,501-64,643,607 (+) |
||||
miRNA | oar-miR-655-5p | ||||
miRNA | oar-miR-655-3p | ||||
Sequence (5' -> 3') (107 nts) |
AACUGUUCAGGGAUAUUUGAGGAGAGGUUAUCCGUGUUAUGUUCGCUUGGCUCAUCAUGAAUAAUACAUGGUUAACCUCUCUUUGAAUAUCAAACUCUGCCUCGAGG | ||||
MFE | -40.60 kcal/mol | ||||
first miRBase version | 17.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (20 precursors) |
oar-mir-376e
oar-mir-376c oar-mir-376d oar-mir-654 oar-mir-376b oar-mir-376a oar-mir-1185 oar-mir-3956 oar-mir-381 oar-mir-487b oar-mir-539 oar-mir-544 oar-mir-655 oar-mir-3959 oar-mir-487a oar-mir-382 oar-mir-134 oar-mir-668 oar-mir-485 oar-mir-323b |
||||
Family | mir-154 (MIPF0000018) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Caiment et al. | Genome Res. | 2010 | 20944086 | Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing. |