| Accession | MI0016811 | ||||
| Name | hsa-mir-4463 | ||||
| similar to following miRCarta precursors | hsa-1517.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr6:75,428,407-75,428,473 (+) |
||||
| miRNA | hsa-miR-4463 | ||||
| Sequence (5' -> 3') (67 nts) |
AAUAGAUUAUUGGUCACCACCUCCAGUUUCUGAAUUUGUGAGACUGGGGUGGGGCCUGAGAAUUUGC | ||||
| MFE | -29.90 kcal/mol | ||||
| first miRBase version | 17.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-4463 |
||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Jima et al. | Blood | 2010 | 20733160 | Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs. |